ID: 1114601031_1114601035

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1114601031 1114601035
Species Human (GRCh38) Human (GRCh38)
Location 14:23955531-23955553 14:23955544-23955566
Sequence CCCCTCTTCTTCAGCTTATAGAG GCTTATAGAGTCAAGTCCCTGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 26, 4: 242} {0: 2, 1: 1, 2: 0, 3: 12, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!