ID: 1114665375_1114665391

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1114665375 1114665391
Species Human (GRCh38) Human (GRCh38)
Location 14:24374430-24374452 14:24374474-24374496
Sequence CCAGACTCCAAGGTGGTGTTCAT CCTGCTGGGGAGGGGAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 134} {0: 2, 1: 1, 2: 18, 3: 233, 4: 1660}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!