|
Left Crispr |
Right Crispr |
| Crispr ID |
1114921774 |
1114921777 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:27341807-27341829
|
14:27341825-27341847
|
| Sequence |
CCCAAATCTCACCTTGAATTGTA |
TTGTAATAATCCCCATGTGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1257, 1: 8964, 2: 10159, 3: 8288, 4: 7147} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|