ID: 1115085734_1115085745

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1115085734 1115085745
Species Human (GRCh38) Human (GRCh38)
Location 14:29512949-29512971 14:29512998-29513020
Sequence CCATGGTCTTGGGCGGCTGACCC CTCCAGCTGCTTTCACAGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!