|
Left Crispr |
Right Crispr |
| Crispr ID |
1115130691 |
1115130694 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:30049237-30049259
|
14:30049271-30049293
|
| Sequence |
CCATCTTCTGCATATAACTACTC |
GACAGCTCTTGGCCTGTCACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 191, 2: 191, 3: 126, 4: 385} |
{0: 4, 1: 163, 2: 189, 3: 146, 4: 232} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|