ID: 1115203023_1115203032

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1115203023 1115203032
Species Human (GRCh38) Human (GRCh38)
Location 14:30874278-30874300 14:30874305-30874327
Sequence CCGCCGTCGGGGCCGCCGGCCCT ACTCGTTGAGACGCCGGCACGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!