ID: 1115555089_1115555104

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1115555089 1115555104
Species Human (GRCh38) Human (GRCh38)
Location 14:34539373-34539395 14:34539423-34539445
Sequence CCGCCTCCCCCCGGGACTGCGCG GCACAAGTAACAGGCACGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 216, 4: 4775} {0: 1, 1: 0, 2: 0, 3: 5, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!