ID: 1115555098_1115555105

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1115555098 1115555105
Species Human (GRCh38) Human (GRCh38)
Location 14:34539397-34539419 14:34539439-34539461
Sequence CCCCATCAGGAAAGCCCTTTGGC CGACAGGCTCCCGAGCCGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 153} {0: 1, 1: 0, 2: 1, 3: 94, 4: 5612}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!