|
Left Crispr |
Right Crispr |
Crispr ID |
1115821276 |
1115821279 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:37214919-37214941
|
14:37214948-37214970
|
Sequence |
CCATCTCTTGTGGAGGGCCTGAC |
CAGGCCCACCCGCAGTTATCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 189, 2: 126, 3: 57, 4: 144} |
{0: 13, 1: 35, 2: 63, 3: 139, 4: 184} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|