ID: 1115999588_1115999593

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1115999588 1115999593
Species Human (GRCh38) Human (GRCh38)
Location 14:39228738-39228760 14:39228767-39228789
Sequence CCGTCCTCTCCTAAGCTCTTTCC TGGTCACATTCCTGCCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 582} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!