ID: 1116679307_1116679311 |
View in Genome Browser |
Spacer: 17 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1116679307 | 1116679311 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 14:47945556-47945578 | 14:47945596-47945618 |
| Sequence | CCTTCACTCTTCTAGAAAGACAT | TCCATGGTTTAGAATAAAAGAGG |
| Strand | - | + |
| Off-target summary | {0: 2, 1: 18, 2: 33, 3: 68, 4: 295} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||