|
Left Crispr |
Right Crispr |
| Crispr ID |
1116889025 |
1116889039 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:50249515-50249537
|
14:50249557-50249579
|
| Sequence |
CCTAGCTCCTGAACAACATTTCT |
AGGGAACCTACTGCCTTGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 26, 2: 89, 3: 231, 4: 548} |
{0: 2, 1: 15, 2: 153, 3: 320, 4: 599} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|