ID: 1117156838_1117156849

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1117156838 1117156849
Species Human (GRCh38) Human (GRCh38)
Location 14:52950683-52950705 14:52950710-52950732
Sequence CCGGGGCTTTCGGCAGAAACTCG GGCGGCGGCGGCCGGGGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 47} {0: 1, 1: 11, 2: 144, 3: 1816, 4: 4157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!