ID: 1117156838_1117156851

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1117156838 1117156851
Species Human (GRCh38) Human (GRCh38)
Location 14:52950683-52950705 14:52950714-52950736
Sequence CCGGGGCTTTCGGCAGAAACTCG GCGGCGGCCGGGGCTGCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 47} {0: 1, 1: 0, 2: 20, 3: 316, 4: 1948}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!