|
Left Crispr |
Right Crispr |
| Crispr ID |
1117171807 |
1117171813 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:53108124-53108146
|
14:53108160-53108182
|
| Sequence |
CCATCCACCACTGCTGTTTGCCA |
GCCGCTGACTTCCATCCCTCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 41, 1: 78, 2: 97, 3: 99, 4: 296} |
{0: 22, 1: 88, 2: 109, 3: 75, 4: 146} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|