ID: 1117216840_1117216847

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1117216840 1117216847
Species Human (GRCh38) Human (GRCh38)
Location 14:53560148-53560170 14:53560196-53560218
Sequence CCTGCCATCTTCTGCAGATAACT GGCCTGTTACTGGGCTTTGTTGG
Strand - +
Off-target summary No data {0: 5, 1: 157, 2: 158, 3: 97, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!