ID: 1117546600_1117546613

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1117546600 1117546613
Species Human (GRCh38) Human (GRCh38)
Location 14:56798423-56798445 14:56798453-56798475
Sequence CCACAGCGCCCTGGGACCGGCGC GCCTGAGAACTACGCCCGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!