ID: 1117634130_1117634136

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1117634130 1117634136
Species Human (GRCh38) Human (GRCh38)
Location 14:57724346-57724368 14:57724391-57724413
Sequence CCTGCCATCTTCTGCAGATAACT GTTGGCCTGTTACTGGGTTTTGG
Strand - +
Off-target summary {0: 185, 1: 187, 2: 104, 3: 111, 4: 225} {0: 1, 1: 14, 2: 199, 3: 176, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!