|
Left Crispr |
Right Crispr |
| Crispr ID |
1117634130 |
1117634137 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:57724346-57724368
|
14:57724394-57724416
|
| Sequence |
CCTGCCATCTTCTGCAGATAACT |
GGCCTGTTACTGGGTTTTGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 185, 1: 187, 2: 104, 3: 111, 4: 225} |
{0: 9, 1: 153, 2: 156, 3: 86, 4: 215} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|