ID: 1118024075_1118024085

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1118024075 1118024085
Species Human (GRCh38) Human (GRCh38)
Location 14:61751198-61751220 14:61751213-61751235
Sequence CCGGGCCCCGCCCGCGGCCCCGG GGCCCCGGCCGTGGGCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 121, 3: 384, 4: 1954} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!