ID: 1118024089_1118024095

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1118024089 1118024095
Species Human (GRCh38) Human (GRCh38)
Location 14:61751221-61751243 14:61751251-61751273
Sequence CCGTGGGCTCCAGGGCTCCAGCC GCGACTTTCGTGTACGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 177, 4: 2011} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!