|
Left Crispr |
Right Crispr |
| Crispr ID |
1118122433 |
1118122436 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:62860159-62860181
|
14:62860197-62860219
|
| Sequence |
CCAGTAACAGGCTAAGAGCTGTC |
AGTTATCTGCAGAAGACGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 170, 2: 192, 3: 145, 4: 175} |
{0: 6, 1: 194, 2: 188, 3: 104, 4: 173} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|