ID: 1118162971_1118162976

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1118162971 1118162976
Species Human (GRCh38) Human (GRCh38)
Location 14:63309491-63309513 14:63309515-63309537
Sequence CCACCAATTCCTCCTGGAAACTG CAAATCCTGAAGCTCCTTCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 21, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!