ID: 1118452994_1118453006

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1118452994 1118453006
Species Human (GRCh38) Human (GRCh38)
Location 14:65920948-65920970 14:65921000-65921022
Sequence CCCCTGAGTCCTGGGCAGGAAGG GATGCTTATGGTCATTAGCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!