|
Left Crispr |
Right Crispr |
| Crispr ID |
1119059455 |
1119059457 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:71460370-71460392
|
14:71460398-71460420
|
| Sequence |
CCCATTGATCTTAATCACAGGGC |
AATACTGAGAGACGCCCTAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 16, 1: 226, 2: 236, 3: 134, 4: 131} |
{0: 1, 1: 47, 2: 214, 3: 249, 4: 216} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|