|
Left Crispr |
Right Crispr |
| Crispr ID |
1119059696 |
1119059699 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:71462179-71462201
|
14:71462213-71462235
|
| Sequence |
CCAGTAACAGACAAAGAGCTGTC |
GAGTAGTTACCTGCAGAAGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 17, 2: 187, 3: 214, 4: 269} |
{0: 1, 1: 11, 2: 198, 3: 200, 4: 257} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|