ID: 1119089937_1119089946

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1119089937 1119089946
Species Human (GRCh38) Human (GRCh38)
Location 14:71772175-71772197 14:71772217-71772239
Sequence CCAGATCTGGAGGGATGGAAGTC CGGCAAACAGCAGTGGTGGATGG
Strand - +
Off-target summary {0: 29, 1: 69, 2: 102, 3: 85, 4: 220} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!