|
Left Crispr |
Right Crispr |
| Crispr ID |
1119107562 |
1119107566 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:71938827-71938849
|
14:71938866-71938888
|
| Sequence |
CCCAGTAATAGGCCAAGAGCTGT |
AGTTACCTGCAGAAGATGACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 16, 1: 194, 2: 203, 3: 147, 4: 222} |
{0: 1, 1: 29, 2: 225, 3: 173, 4: 262} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|