ID: 1119324293_1119324300

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1119324293 1119324300
Species Human (GRCh38) Human (GRCh38)
Location 14:73750497-73750519 14:73750515-73750537
Sequence CCCCTGGAAGCCAAGAGAGCCCA GCCCAAAGGGTGTTGAGGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 276} {0: 1, 1: 0, 2: 1, 3: 4, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!