ID: 1119324295_1119324300

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1119324295 1119324300
Species Human (GRCh38) Human (GRCh38)
Location 14:73750499-73750521 14:73750515-73750537
Sequence CCTGGAAGCCAAGAGAGCCCAAA GCCCAAAGGGTGTTGAGGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 274} {0: 1, 1: 0, 2: 1, 3: 4, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!