ID: 1119332072_1119332083

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1119332072 1119332083
Species Human (GRCh38) Human (GRCh38)
Location 14:73802462-73802484 14:73802497-73802519
Sequence CCTTTCAACGAGGGTTTGCAGGG GGTGCTGAGGATGCCAGGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 72, 4: 585}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!