ID: 1119549028_1119549040

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1119549028 1119549040
Species Human (GRCh38) Human (GRCh38)
Location 14:75494704-75494726 14:75494728-75494750
Sequence CCAACACCCCATCTTCCCATCCC ATGATGCCCAAAGGGTCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 91, 4: 909} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!