|
Left Crispr |
Right Crispr |
Crispr ID |
1120813728 |
1120813738 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:88831278-88831300
|
14:88831330-88831352
|
Sequence |
CCTAGAAAGTTCTAAATAACTTG |
ATTTGCATGTAATTGAAAGTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 8, 2: 23, 3: 57, 4: 359} |
{0: 26, 1: 115, 2: 189, 3: 287, 4: 465} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|