|
Left Crispr |
Right Crispr |
| Crispr ID |
1121268137 |
1121268139 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:92617945-92617967
|
14:92617970-92617992
|
| Sequence |
CCATGGAAAAAGGACCTAATAAA |
ATGCCCTTCTAGAAGAGTGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 41, 2: 41, 3: 47, 4: 292} |
{0: 13, 1: 53, 2: 41, 3: 37, 4: 140} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|