ID: 1121741096_1121741109

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1121741096 1121741109
Species Human (GRCh38) Human (GRCh38)
Location 14:96252881-96252903 14:96252909-96252931
Sequence CCACCCCAGAGCCAGCACCCAGG TCACTTCTGGGCTGGCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 58, 4: 606} {0: 1, 1: 0, 2: 1, 3: 38, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!