ID: 1121741105_1121741115

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1121741105 1121741115
Species Human (GRCh38) Human (GRCh38)
Location 14:96252899-96252921 14:96252944-96252966
Sequence CCAGGACCCTTCACTTCTGGGCT CTGGAGCTGCCTGAATGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 275} {0: 1, 1: 1, 2: 5, 3: 61, 4: 823}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!