ID: 1121928657_1121928666

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1121928657 1121928666
Species Human (GRCh38) Human (GRCh38)
Location 14:97952125-97952147 14:97952163-97952185
Sequence CCAGTGTAAATGCATCTCCTCTA GGATAATGGCTGGGGTTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135} {0: 1, 1: 0, 2: 1, 3: 13, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!