ID: 1122018352_1122018362

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1122018352 1122018362
Species Human (GRCh38) Human (GRCh38)
Location 14:98816440-98816462 14:98816481-98816503
Sequence CCGTGCTGTCCTGTTCCAGGCAC TTGGTCAGAGGTGGTTTCCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!