ID: 1122076024_1122076027

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1122076024 1122076027
Species Human (GRCh38) Human (GRCh38)
Location 14:99235116-99235138 14:99235145-99235167
Sequence CCATCCGGGTTTCAGGGGGAATT TTCCCCACCCCTGAAGCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 79} {0: 1, 1: 0, 2: 6, 3: 23, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!