ID: 1122076024_1122076028

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1122076024 1122076028
Species Human (GRCh38) Human (GRCh38)
Location 14:99235116-99235138 14:99235146-99235168
Sequence CCATCCGGGTTTCAGGGGGAATT TCCCCACCCCTGAAGCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 79} {0: 1, 1: 1, 2: 4, 3: 37, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!