ID: 1122076025_1122076037

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1122076025 1122076037
Species Human (GRCh38) Human (GRCh38)
Location 14:99235120-99235142 14:99235164-99235186
Sequence CCGGGTTTCAGGGGGAATTCGAG CTGGGGCGTCCCCTCCCAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66} {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!