ID: 1122273207_1122273223

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1122273207 1122273223
Species Human (GRCh38) Human (GRCh38)
Location 14:100577644-100577666 14:100577697-100577719
Sequence CCAGCGGCCCAGGCGTGCGAGGG GGGACTCTGGGGAGGAAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 132} {0: 1, 1: 0, 2: 6, 3: 98, 4: 789}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!