ID: 1122273215_1122273223

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1122273215 1122273223
Species Human (GRCh38) Human (GRCh38)
Location 14:100577679-100577701 14:100577697-100577719
Sequence CCCGGCTGCCTGTGTTCAGGGAC GGGACTCTGGGGAGGAAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 318} {0: 1, 1: 0, 2: 6, 3: 98, 4: 789}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!