ID: 1122273216_1122273222

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1122273216 1122273222
Species Human (GRCh38) Human (GRCh38)
Location 14:100577680-100577702 14:100577693-100577715
Sequence CCGGCTGCCTGTGTTCAGGGACT TTCAGGGACTCTGGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 225} {0: 1, 1: 0, 2: 2, 3: 46, 4: 539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!