ID: 1122389955_1122389959 |
View in Genome Browser |
Spacer: -9 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1122389955 | 1122389959 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 14:101373411-101373433 | 14:101373425-101373447 |
| Sequence | CCTGAGTCCTGGCTGAGCCTCTG | GAGCCTCTGGAACATGGAAGAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 4, 3: 52, 4: 456} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||