ID: 1122658616_1122658620

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1122658616 1122658620
Species Human (GRCh38) Human (GRCh38)
Location 14:103279445-103279467 14:103279462-103279484
Sequence CCCGGGCGTGTGCAGCGAGGCCT AGGCCTCGTTCCGGGCCGTGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 32, 4: 119} {0: 1, 1: 1, 2: 0, 3: 4, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!