ID: 1122707193_1122707207

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1122707193 1122707207
Species Human (GRCh38) Human (GRCh38)
Location 14:103628947-103628969 14:103628972-103628994
Sequence CCCCGAGCGCCCCACCCCCGTCC GTTACAACCGGGAGGCCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 498} {0: 1, 1: 0, 2: 0, 3: 0, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!