ID: 1122794989_1122795004

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1122794989 1122795004
Species Human (GRCh38) Human (GRCh38)
Location 14:104201579-104201601 14:104201632-104201654
Sequence CCCCCGCCACACCCCTTTTCTGC TGCAGGACAGGCCCCAACTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!