ID: 1122812439_1122812444

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1122812439 1122812444
Species Human (GRCh38) Human (GRCh38)
Location 14:104295729-104295751 14:104295754-104295776
Sequence CCGGGCGGCGCGTGCACTTGGCC GGCAGCCCTGCGTGACGAATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 1, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!