ID: 1122817513_1122817526

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1122817513 1122817526
Species Human (GRCh38) Human (GRCh38)
Location 14:104320892-104320914 14:104320931-104320953
Sequence CCACACCCAGCTGGAGAGGAGGA GGGACTCTCGGCAGAGGCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 25, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!